UNPKG

react-sequence-viewer

Version:

A React wrapper around the BioJS sequence-viewer component

115 lines (83 loc) 3.73 kB
# react-sequence-viewer ## Description A [React](https://facebook.github.io/react/) wrapper around the [BioJS](https://biojs.net/) [sequence-viewer](https://github.com/calipho-sib/sequence-viewer) component. ## Installation ``` npm install --save react-sequence-viewer ``` ## Dependencies The following are dependencies required by the `sequence-viewer` module that is wrapped by this React component. * jQuery * Bootstrap CSS You can either include these into your HTML page or add them to your own application build (see usage below). ```html <script src="https://ajax.googleapis.com/ajax/libs/jquery/3.1.1/jquery.min.js"></script> <link rel="stylesheet" type="text/css" href="https://maxcdn.bootstrapcdn.com/bootstrap/3.3.7/css/bootstrap.min.css"></link> ``` ## Usage The following code renders a sequence-viewer component in the HTML element with an ID of 'sequence-viewer1'. **ES6** ```jsx import React from 'react'; import ReactDOM from 'react-dom'; // Either uncomment these lines or pull // in jQuery and Bootstrap into the HTML page of your application. // The below requires that jQuery/Bootstrap be installed as a dependency // in your package.json file. //import jquery from 'jquery'; //window.jQuery = jquery; //import 'bootstrap/dist/css/bootstrap.min.css'; import ReactSequenceViewer from 'react-sequence-viewer'; const mySeq = 'CAGTCGATCGTAGCTAGCTAGCTGATCGATGC'; ReactDOM.render( <ReactSequenceViewer sequence={mySeq} />, document.getElementById('#sequence-viewer1') ); ``` ```jsx import React from 'react'; import ReactDOM from 'react-dom'; // Either uncomment these lines or pull // in jQuery and Bootstrap into the HTML page of your application. // The below requires that jQuery/Bootstrap be installed as a dependency // in your package.json file. //import jquery from 'jquery'; //window.jQuery = jquery; //import 'bootstrap/dist/css/bootstrap.min.css'; import ReactSequenceViewer from 'react-sequence-viewer'; const mySeq = 'CAGTCGATCGTAGCTAGCTAGCTGATCGATGC'; const options = { badge: true, search: false, showLineNumbers: true, title: "my sequence", toolbar: false, }; ReactDOM.render( <ReactSequenceViewer sequence={mySeq} {...options} />, document.getElementById('#sequence-viewer1') ); ``` ## Properties / Options Please see the [Sequence Viewer documentation](https://cdn.rawgit.com/calipho-sib/sequence-viewer/master/examples/index.html) for more details on the options below. | Name | Description | Type | Required | Comment | |:-----|:------------|------|----------|:--------| | className | HTML class name to apply to the Sequence Viewer div container | String | No | | | coverage | Advanced sequence hightlighting | Array[Objects] | No | Not compatible with `selection` | | id | The ID to use for the Sequence Viewer container element | String | No | | | legend | Adds a legend to the sequence | Array[Objects] | No | | | onMouseSelection | Event handler for sequence selection with the mouse | function | No | | | onSubpartSelected | Event handler for sequence selected via the search box | function | No | | | selection | A region to highlight | Array | No | Not compatible with `coverage` | | sequence | The sequence to render. | String | Yes | | [build-badge]: https://img.shields.io/travis/FlyBase/react-sequence-viewer/master.png?style=flat-square [build]: https://travis-ci.org/FlyBase/react-sequence-viewer [npm-badge]: https://img.shields.io/npm/v/react-sequence-viewer.png?style=flat-square [npm]: https://www.npmjs.org/package/react-sequence-viewer [coveralls-badge]: https://img.shields.io/coveralls/FlyBase/react-sequence-viewer/master.png?style=flat-square [coveralls]: https://coveralls.io/github/FlyBase/react-sequence-viewer