UNPKG

dwt

Version:

Dynamic Web TWAIN is a TWAIN/ICA/SANE-based scanning SDK software specifically designed for web applications running on Windows/macOS/Linux. With just a few lines of code, you can develop robust applications to scan documents from TWAIN/ICA/SANE-compatibl

1,388 lines (1,386 loc) 163 kB
openapi: 3.0.1 info: title: DWT description: '' version: '20250428' tags: - name: Server Control - name: Scanner Control - name: Document Management - name: Document Processing paths: /server: get: summary: Get the server settings. deprecated: false description: | Get the server settings. Some settings can only be retrieved by the admin. operationId: getServerSettings tags: - Server Control parameters: [] responses: '200': description: Successful operation content: application/json: schema: $ref: '#/components/schemas/ServerSettings' example: logLevel: 1 headers: {} '405': description: Method not allowed content: application/json: schema: &ref_0 $ref: '#/components/schemas/Error' example: code: -2112 message: This endpoint only supports GET and PATCH. statusCode: 405 headers: {} security: [] patch: summary: Update only specified server settings. deprecated: false description: > Update only specified server settings. Some settings can only be updated by the admin. operationId: patchServerSettings tags: - Server Control parameters: [] requestBody: content: application/json: schema: $ref: '#/components/schemas/ServerSettingsInput' example: '' responses: '200': description: Successful operation content: application/json: schema: type: object properties: logLevel: type: integer format: int32 default: 0 description: server log level. example: logLevel: 1 headers: {} '400': description: Bad request. e.g. parameter is invalid. content: application/json: schema: *ref_0 example: code: -2113 message: The parameter is not valid. statusCode: 400 headers: {} '405': description: Method not allowed content: application/json: schema: *ref_0 example: code: -2112 message: This endpoint only supports GET and PATCH. statusCode: 405 headers: {} security: [] /server/version: get: summary: Get the server API version. deprecated: false description: In the future, the client can pass the API version to call different API versions. operationId: getServerVersion tags: - Server Control parameters: [] responses: '200': description: Successful operation content: application/json: schema: type: object properties: version: type: string description: server API version. example: - '20240719' compatible: type: boolean description: server is compatible with the client. example: - true headers: {} '405': description: Method not allowed content: application/json: schema: *ref_0 example: code: -2112 message: This endpoint only supports GET. statusCode: 405 headers: {} security: [] /device/scanners: get: summary: Retrieve a list scanners deprecated: false description: '' operationId: getScanners tags: - Scanner Control parameters: - name: type in: query description: > Device type. It can be one type or a combination. The default uses TWAIN/TWAIN64/WIA/ICA/SANE. required: false schema: &ref_2 $ref: '#/components/schemas/ScannerType' description: one value of ScannerType example: - 16 responses: '200': description: Successful operation content: application/json: schema: type: array items: &ref_3 $ref: '#/components/schemas/Scanner' example: - name: TWAIN2 FreeImage Software Scanner type: 16 device: >- {"deviceInfo":{"Manufacturer":"VFdBSU4gV29ya2luZyBHcm91cA==","ProductFamily":"U29mdHdhcmUgU2Nhbg==","ProductName":"VFdBSU4yIEZyZWVJbWFnZSBTb2Z0d2FyZSBTY2FubmVy","ProtocolMajor":2,"ProtocolMinor":1,"SupportedGroups":0,"Version":{"Country":1,"Info":"Mi4xLjMgc2FtcGxlIHJlbGVhc2UgMzJiaXQ=","Language":2,"MajorNum":2,"MinorNum":1}},"deviceType":16,"isSystemDefaultPrinter":false,"name":"VFdBSU4yIEZyZWVJbWFnZSBTb2Z0d2FyZSBTY2FubmVy"} headers: {} '400': description: Bad request. e.g. parameter is invalid. content: application/json: schema: *ref_0 example: code: -2113 message: The parameter is not valid. statusCode: 400 headers: {} '405': description: Method not allowed content: application/json: schema: *ref_0 example: code: -2112 message: This endpoint only supports GET. statusCode: 405 headers: {} security: [] /device/scanners/jobs: post: summary: Create a scan job deprecated: false description: > You can scan with the specified scanner. If the scanner is not specified, the last used scanner or the defalut scanner will be used. You can set capabilities of the scanner. You can show the scanner ui if you are operating on the machine running Dynamic Web TWAIN Service. You can get scanned image with the job uid, or save to the specified document. You can create a pending job with the specified scanner. One scanner can only have one pending job. If the scanner is shared, it is recommended to create a pending job for the specified scanner. Default other requests for the job will only allow the domain when job created. Once the job was created, you have to delete the job manually unless you set a jobTimeout and it times out. operationId: createScanJob tags: - Scanner Control parameters: - name: DWT-PRODUCT-KEY in: header description: Product key required: true example: '' schema: type: string requestBody: content: application/json: schema: $ref: '#/components/schemas/CreateScanJobOptions' example: '' responses: '201': description: Successful operation content: application/json: schema: $ref: '#/components/schemas/ScannerJob' headers: {} '400': description: Bad request. e.g. parameter is invalid. content: application/json: schema: *ref_0 example: code: -2113 message: The parameter is not valid. statusCode: 400 headers: {} '403': description: The license is invalid. content: application/json: schema: *ref_0 example: code: -2800 message: >- The current product key is empty or invalid. Please contact the site administrator. statusCode: 403 headers: {} '405': description: Method not allowed content: application/json: schema: *ref_0 example: code: -2112 message: This endpoint only supports POST. statusCode: 405 headers: {} '423': description: The scanner is currently in use. content: application/json: schema: *ref_0 example: code: -1004 message: >- The source is connected to the maximum supported number of applications. statusCode: 423 headers: {} security: [] /device/scanners/jobs/{jobuid}: get: summary: Retrieve the scan job status. deprecated: false description: | You can get the job status. operationId: getScanJobStatus tags: - Scanner Control parameters: - name: jobuid in: path description: '' required: true example: '' schema: type: string responses: '200': description: Successful operation content: application/json: schema: type: object required: - status - code - message properties: status: type: string enum: - pending - running - completed - faulted - canceled description: scanner job status code: type: number description: error code default: '0' message: type: string description: error message default: Successful description: Scanner Job Information headers: {} '404': description: Error resonpse content: application/json: schema: *ref_0 example: code: -1034 message: This provided job UID is invalid. statusCode: 404 headers: {} '405': description: Method not allowed content: application/json: schema: *ref_0 example: code: -2112 message: This endpoint only supports GET, PATCH and DELETE. statusCode: 405 headers: {} '410': description: >- The job was deleted. If the service restarted and all the jobs were lost, it will return 404. content: application/json: schema: *ref_0 example: code: -1034 message: Invalid Value. statusCode: 410 headers: {} security: [] patch: summary: Update the scan job status. deprecated: false description: > When the job status is pending, you can update the status of the job. Otherwise, it will be ignored. operationId: updateScanJob tags: - Scanner Control parameters: - name: jobuid in: path description: '' required: true example: '' schema: type: string requestBody: content: application/json: schema: type: object properties: status: type: string default: running enum: - running - canceled description: > Update the job status. If the job is running, it only accepts Canceled to cancel the job. If the job is pending, it only accepts Running to start the job. required: - status example: '' responses: '200': description: Successful operation content: application/json: schema: type: object properties: status: type: string enum: - running - canceled default: running description: scanner job status. required: - status headers: {} '400': description: Error resonpse content: application/json: schema: *ref_0 example: code: -2113 message: The parameter is not valid. statusCode: 400 headers: {} '404': description: '' content: application/json: schema: *ref_0 example: code: -1034 message: This provided job UID is invalid. statusCode: 404 headers: {} '405': description: Method not allowed content: application/json: schema: *ref_0 example: code: -2112 message: This endpoint only supports GET, PATCH and DELETE. statusCode: 405 headers: {} '409': description: >- When you try to cancel a not pending or running job, update a not pending job to running. content: application/json: schema: *ref_0 example: code: -1011 message: Operation out of expected sequence. statusCode: 409 headers: {} '410': description: The job was deleted. content: application/json: schema: *ref_0 example: code: -1034 message: Invalid Value. statusCode: 410 headers: {} security: [] delete: summary: Delete the scan job deprecated: false description: > If the job is running, the job will be canceled first, and then be deleted, including all scanned documents. operationId: deleteScanJob tags: - Scanner Control parameters: - name: jobuid in: path description: '' required: true example: '' schema: type: string responses: '204': description: Successful operation headers: {} '404': description: Error resonpse content: application/json: schema: *ref_0 example: code: -1034 message: This provided job UID is invalid. statusCode: 404 headers: {} '405': description: Method not allowed content: application/json: schema: *ref_0 example: code: -2112 message: This endpoint only supports GET, PATCH and DELETE. statusCode: 405 headers: {} '410': description: The job was deleted. content: application/json: schema: *ref_0 example: code: -1034 message: Invalid Value. statusCode: 410 headers: {} security: [] /device/scanners/jobs/{jobuid}/scanner/capabilities: get: summary: Retrieve the capabilities of the scanner specified in the scan job. deprecated: false description: > You can get the capabilities of scanner specified in the job, but it is only valid when the job is pending. operationId: getCurrentScannerCapabilities tags: - Scanner Control parameters: - name: jobuid in: path description: '' required: true example: '' schema: type: string - name: caps in: query description: '' required: false schema: type: string description: > capability id. multiple values seperated by commas. e.g. caps=5,2,1. If no pages specified, return all capabilities. externalDocs: url: >- https://www.dynamsoft.com/web-twain/docs/info/api/Dynamsoft_Enum.html#dynamsoftDWTenumDWT_cap responses: '200': description: Successful operation content: application/json: schema: type: array externalDocs: url: >- https://www.dynamsoft.com/web-twain/docs/info/api/Interfaces.html#capabilitydetails properties: {} items: type: object properties: {} headers: {} '400': description: Error resonpse content: application/json: schema: *ref_0 example: code: -2113 message: The parameter is not valid. statusCode: 400 headers: {} '404': description: '' content: application/json: schema: *ref_0 example: code: -1034 message: This provided job UID is invalid. statusCode: 404 headers: {} '405': description: Method not allowed content: application/json: schema: *ref_0 example: code: -2112 message: This endpoint only supports GET. statusCode: 405 headers: {} '409': description: Support only when the scan job is pending. content: application/json: schema: *ref_0 example: code: -1011 message: Operation out of expected sequence. statusCode: 409 headers: {} '410': description: The job was deleted. content: application/json: schema: *ref_0 example: code: -1034 message: Invalid Value. statusCode: 410 headers: {} security: [] /device/scanners/jobs/{jobuid}/scanner/settings: get: summary: Retrieve the settings of the scanner specified in the scan job. deprecated: false description: > You can get the scanner settings. It only supports TWAIN scanners, and it is only valid when the job is pending. We will call EnableSourceUI to get the settings. operationId: getCurrentScannerSettings tags: - Scanner Control parameters: - name: jobuid in: path description: '' required: true example: '' schema: type: string - name: showui in: query description: '' required: false schema: type: boolean default: true description: > If true, will show the UI for the user to set the scanner settings. If false, will not show the UI. responses: '200': description: Successful operation content: application/json: schema: type: object properties: settings: type: string description: base64 encoded example: settings: >- Rfj6pIMTNkCu3BfDloGItBAAAAACEAAABgAFAAEAAAAQAAAAExAAAAYABQAAAAAAEAAAAAcQAAAGAAUAAQAAABAAAAArEQAABAAFABgAAAAQAAAAHBEAAAQABQAAAAAAEAAAAAABAAAEAAUAAAAAABwAAAAUEQAACAAFAPgqAAAAAAAANCEAAAAAAAAQAAAADBEAAAQABQACAAAAEAAAAB8RAAAEAAUAAAAAABAAAAABAQAABAAFAAIAAAAQAAAAIBEAAAQABQAAAAAAEAAAACIRAAAEAAUAAwAAABAAAAAQEQAABAAFAAAAAAAQAAAAAgEAAAQABQAAAAAAEAAAABgRAAAHAAUAAABIQxAAAAAZEQAABwAFAAAASEMQAAAAIxEAAAcABQAAAABDEAAAAAMRAAAHAAUAAAAAABAAAAABEQAABwAFAAAAAAAQAAAACBEAAAcABQAAAIA/EAAAAAGAAAAGAAUAAAAAAA== headers: {} '400': description: Error resonpse content: application/json: schema: *ref_0 example: code: -2113 message: The parameter is not valid. statusCode: 400 headers: {} '404': description: '' content: application/json: schema: *ref_0 example: code: -1034 message: This provided job UID is invalid. statusCode: 404 headers: {} '405': description: Method not allowed content: application/json: schema: *ref_0 example: code: -2112 message: This endpoint only supports GET. statusCode: 405 headers: {} '409': description: The job is not in pending. content: application/json: schema: *ref_0 example: code: -1011 message: Operation out of expected sequence. statusCode: 409 headers: {} '410': description: The job was deleted. content: application/json: schema: *ref_0 example: code: -1034 message: Invalid Value. statusCode: 410 headers: {} security: [] /device/scanners/jobs/{jobuid}/next-page-info: get: summary: Get the next page information for a specific job. deprecated: false description: > Get the next scanned page info. If the scanned page is not ready, it will not return until the page is ready. If the response code is 200, we can try to get the next until the reponse code is 204. operationId: getNextScannedPageInfo tags: - Scanner Control parameters: - name: jobuid in: path description: '' required: true example: '' schema: type: string responses: '200': description: >- Successful operation. We will also return the image url; if scan to a document, also return document uid and page uid. content: application/json: schema: type: array items: $ref: '#/components/schemas/ScanDocumentInfo' headers: {} '204': description: No more pages. scan done. headers: {} '404': description: '' content: application/json: schema: *ref_0 example: code: -1034 message: This provided job UID is invalid. statusCode: 404 headers: {} '405': description: Method not allowed content: application/json: schema: *ref_0 example: code: -2112 message: This endpoint only supports GET. statusCode: 405 headers: {} '410': description: The job was deleted. content: application/json: schema: type: object properties: {} example: code: -1034 message: Invalid Value. statusCode: 410 headers: {} security: [] /device/scanners/jobs/{jobuid}/next-page: get: summary: Get the next page for a specific job. deprecated: false description: > Get the next scanned page content. If the scanned page is not ready, it will not return until the page is ready. If the response code is 200, we can try to get the next until the reponse code is 204. operationId: getNextScannedPage tags: - Scanner Control parameters: - name: jobuid in: path description: '' required: true example: '' schema: type: string - name: type in: query description: '' required: false schema: type: string enum: - image/jpeg - image/png default: image/png description: mime type responses: '200': description: Successful operation. return image/png or image/jpeg stream. content: image/jpeg: schema: type: object properties: {} example: "ÿØÿà \x10JFIF \x01\x01\x01 ` ` ÿá ZExif MM * \b \x05\x03\x01 \x05 \x01 J\x03\x03 \x01 \x01 Q\x10 \x01 \x01\x01 Q\x11 \x04 \x01 \x0EÃQ\x12 \x04 \x01 \x0Eà \x01†\_ ±\x8FÿÛ C \x02\x01\x01\x02\x01\x01\x02\x02\x02\x02\x02\x02\x02\x02\x03\x05\x03\x03\x03\x03\x03\x06\x04\x04\x03\x05\a\x06\a\a\a\x06\a\a\b\t\v\t\b\b\r\n\b\a\a\r\n\r\n\r\n\v\f\f\f\f\a\t\x0E\x0F\r\n\f\x0E\v\f\f\fÿÛ C\x01\x02\x02\x02\x03\x03\x03\x06\x03\x03\x06\f\b\a\b\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\fÿÀ \x11\b \x01 \x01\x03\x01\" \x02\x11\x01\x03\x11\x01ÿÄ \x1F \x01\x05\x01\x01\x01\x01\x01\x01 \x01\x02\x03\x04\x05\x06\a\b\t\r\n\vÿÄ µ\x10 \x02\x01\x03\x03\x02\x04\x03\x05\x05\x04\x04 \x01}\x01\x02\x03 \x04\x11\x05\x12!1A\x06\x13Qa\a\"q\x142\x81‘¡\b#B±Á\x15RÑð$3br‚\t\r\n\x16\x17\x18\x19\x1A%&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyzƒ„…†‡ˆ‰Š’“”•–—˜™š¢£¤¥¦§¨©ª²³´µ¶·¸¹ºÂÃÄÅÆÇÈÉÊÒÓÔÕÖרÙÚáâãäåæçèéêñòóôõö÷øùúÿÄ \x1F\x01 \x03\x01\x01\x01\x01\x01\x01\x01\x01\x01 \x01\x02\x03\x04\x05\x06\a\b\t\r\n\vÿÄ µ\x11 \x02\x01\x02\x04\x04\x03\x04\a\x05\x04\x04 \x01\x02w \x01\x02\x03\x11\x04\x05!1\x06\x12AQ\aaq\x13\"2\x81\b\x14B‘¡±Á\t#3Rð\x15brÑ\r\n\x16$4á%ñ\x17\x18\x19\x1A&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz‚ƒ„…†‡ˆ‰Š’“”•–—˜™š¢£¤¥¦§¨©ª²³´µ¶·¸¹ºÂÃÄÅÆÇÈÉÊÒÓÔÕÖרÙÚâãäåæçèéêòóôõö÷øùúÿÚ \f\x03\x01 \x02\x11\x03\x11 ? ýü¢Š(\x03ÿÙ" headers: {} '204': description: No more pages. scan done. headers: {} '400': description: Error resonpse content: application/json: schema: *ref_0 example: code: -2113 message: The parameter is not valid. statusCode: 400 headers: {} '404': description: '' content: application/json: schema: *ref_0 example: code: -1034 message: This provided job UID is invalid. statusCode: 404 headers: {} '405': description: Method not allowed content: application/json: schema: *ref_0 example: code: -2112 message: This endpoint only supports GET. statusCode: 405 headers: {} '410': description: The job was deleted. content: application/json: schema: *ref_0 example: code: -1034 message: Invalid Value. statusCode: 410 headers: {} x-200-2: description: '' content: image/png: schema: type: object properties: {} example: "‰PNG\r\n\x1A\r\n \r\nIHDR \x01 \x01\b\x02 \x90wSÞ \x01sRGB ®Î\x1Cé \x04gAMA ±\x8F\vüa\x05 \tpHYs \x0Eà \x0EÃ\x01Ço¨d \fIDAT\x18Wcøÿÿ? \x05þ\x02þ§5\x81„ IEND®B`‚" headers: {} security: [] /storage/documents: post: summary: Create a new document. deprecated: false description: >- The document will be stored in the Dynamic Web TWAIN Service working folder and all the contents will be encrypted. operationId: createDocument tags: - Document Management parameters: [] requestBody: content: application/json: schema: $ref: '#/components/schemas/CreateDocumentOptions' description: password for the document example: '' responses: '201': description: Successful operation content: application/json: schema: &ref_1 description: document info $ref: '#/components/schemas/DocumentInfo' example: uid: 190807444d76 pages: [] headers: {} '400': description: Error resonpse content: application/json: schema: *ref_0 example: code: -2113 message: The parameter is not valid. statusCode: 400 headers: {} '405': description: Method not allowed content: application/json: schema: *ref_0 example: code: -2112 message: This endpoint only supports POST. statusCode: 405 headers: {} security: [] /storage/documents/{documentuid}: get: summary: Retrieve document info deprecated: false description: Retrieve the document info, including pages info. operationId: getDocumentInfo tags: - Document Management parameters: - name: documentuid in: path description: UID of document required: true example: '' schema: type: string - name: DWT-DOC-PASSWORD in: header description: the password of document in storage required: false example: '' schema: type: string maxLength: 32 description: cannot exceed 32 chars. responses: '200': description: Successful operation content: application/json: schema: *ref_1 example: uid: 190807444d76 pages: - uid: 190817548d70 - uid: '190817648270' headers: {} '400': description: Bad request. content: application/json: schema: *ref_0 example: code: -2113 message: The parameter is not valid. statusCode: 400 headers: {} '403': description: '' content: application/json: schema: *ref_0 example: code: -1043 message: Password invalid. statusCode: 403 headers: {} '404': description: '' content: application/json: schema: *ref_0 example: code: -1040 message: The uid does not exist. statusCode: 404 headers: {} '405': description: Method not allowed content: application/json: schema: *ref_0 example: code: -2112 message: This endpoint only supports GET and DELETE. statusCode: 405 headers: {} security: [] delete: summary: Delete the document. deprecated: false description: All the data will be deleted. operationId: deleteDocument tags: - Document Management parameters: - name: documentuid in: path description: UID of document required: true example: '' schema: type: string - name: DWT-DOC-PASSWORD in: header description: the password of document in storage required: false example: '' schema: type: string maxLength: 32 description: cannot exceed 32 chars. responses: '204': description: Successful operation headers: {} '400': description: '' content: application/json: schema: *ref_0 example: code: -2113 message: The parameter is not valid. statusCode: 400 headers: {} '403': description: '' content: application/json: schema: *ref_0 example: code: -1043 message: Password invalid. statusCode: 403 headers: {} '404': description: Error resonpse content: application/json: schema: *ref_0 example: code: -1040 message: The uid does not exist. statusCode: 404 headers: {} '405': description: '' content: application/json: schema: *ref_0 example: code: -2112 message: This endpoint only supports GET and DELETE. statusCode: 405 headers: {} security: [] /storage/documents/{documentuid}/content: get: summary: Retrieve the document content with specified format. deprecated: false description: > Can specify one or more pages with page index or uid, otherwise, the whole document. Also can specify pdf info, and encryption. operationId: getDocContent tags: - Document Management parameters: - name: documentuid in: path description: UID of document required: true example: '' schema: type: string - name: type in: query description: output mime type required: false schema: type: string enum: - image/jpeg - image/png - image/tiff - application/pdf default: application/pdf description: | Specified the output format. - name: quality in: query description: '' required: false schema: type: integer format: int32 minimum: 1 maximum: 100 default: 80 description: >- range is 0 to 100. only valid for jpeg/jpeg2000 compression. - name: pages in: query description: '' required: false schema: type: string default: '' description: > page indices or uids. multiple values seperated by commas. e.g. pages=5,2,1. If no pages specified, for image/png, image/jpeg, only return first page; for image/tiff, application/pdf, return all pages. - name: author in: query description: '' required: false schema: type: string default: '' externalDocs: url: >- https://www.dynamsoft.com/web-twain/docs/info//api/interfaces.html#pdfwsettings - name: compression in: query description: >- for tiff, please refer to https://www.dynamsoft.com/web-twain/docs/info/api/Dynamsoft_Enum.html#dynamsoftDWTenumDWT_tiffcompressiontype for pdf, please refer to https://www.dynamsoft.com/web-twain/docs/info/api/Dynamsoft_Enum.html#dynamsoftDWTenumDWT_pdfcompressiontype required: false schema: type: integer format: int32 default: 0 description: auto, BW use JBIG2, GrayScale & Color use Jpeg externalDocs: url: >- https://www.dynamsoft.com/web-twain/docs/info//api/interfaces.html#pdfwsettings - name: pageType in: query description: '' required: false schema: type: integer format: int32 default: 0 description: page size externalDocs: url: >- https://www.dynamsoft.com/web-twain/docs/info//api/interfaces.html#pdfwsettings - name: creator in: query description: '' required: false schema: type: string default: '' externalDocs: url: >- https://www.dynamsoft.com/web-twain/docs/info//api/interfaces.html#pdfwsettings - name: creationDate in: query description: '' required: false schema: type: string default: '' externalDocs: url: >- https://www.dynamsoft.com/web-twain/docs/info//api/interfaces.html#pdfwsettings - name: keyWords in: query description: '' required: false schema: type: string default: '' externalDocs: url: >- https://www.dynamsoft.com/web-twain/docs/info//api/interfaces.html#pdfwsettings - name: modifiedDate in: query description: '' required: false schema: type: string default: '' externalDocs: url: >- https://www.dynamsoft.com/web-twain/docs/info//api/interfaces.html#pdfwsettings - name: producer in: query description: '' required: false schema: type: string default: '' externalDocs: url: >- https://www.dynamsoft.com/web-twain/docs/info//api/interfaces.html#pdfwsettings - name: subject in: query description: '' required: false schema: type: string default: '' externalDocs: url: >- https://www.dynamsoft.com/web-twain/docs/info//api/interfaces.html#pdfwsettings - name: title in: query description: '' required: false schema: type: string default: '' externalDocs: url: >- https://www.dynamsoft.com/web-twain/docs/info//api/interfaces.html#pdfwsettings - name: version in: query description: '' required: false schema: type: string default: '1.5' externalDocs: url: >- https://www.dynamsoft.com/web-twain/docs/info//api/interfaces.html#pdfwsettings - name: password in: query description: '' required: false schema: type: string maxLength: 32 default: '' description: password to encrypt pdf. externalDocs: url: >- https://www.dynamsoft.com/web-twain/docs/info//api/interfaces.html#pdfwsettings - name: DWT-DOC-PASSWORD in: header description: the password of document in storage required: false example: '' schema: type: string maxLength: 32 description: cannot exceed 32 chars. responses: '200': description: Successful operation content: image/jpeg: schema: type: object properties: {} example: "ÿØÿà \x10JFIF \x01\x01\x01 ` ` ÿá ZExif MM * \b \x05\x03\x01 \x05 \x01 J\x03\x03 \x01 \x01 Q\x10 \x01 \x01\x01 Q\x11 \x04 \x01 \x0EÃQ\x12 \x04 \x01 \x0Eà \x01† ±\x8FÿÛ C \x02\x01\x01\x02\x01\x01\x02\x02\x02\x02\x02\x02\x02\x02\x03\x05\x03\x03\x03\x03\x03\x06\x04\x04\x03\x05\a\x06\a\a\a\x06\a\a\b\t\v\t\b\b\r\n\b\a\a\r\n\r\n\r\n\v\f\f\f\f\a\t\x0E\x0F\r\n\f\x0E\v\f\f\fÿÛ C\x01\x02\x02\x02\x03\x03\x03\x06\x03\x03\x06\f\b\a\b\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\fÿÀ \x11\b \x01 \x01\x03\x01\" \x02\x11\x01\x03\x11\x01ÿÄ \x1F \x01\x05\x01\x01\x01\x01\x01\x01 \x01\x02\x03\x04\x05\x06\a\b\t\r\n\vÿÄ µ\x10 \x02\x01\x03\x03\x02\x04\x03\x05\x05\x04\x04 \x01}\x01\x02\x03 \x04\x11\x05\x12!1A\x06\x13Qa\a\"q\x142\x81‘¡\b#B±Á\x15RÑð$3br‚\t\r\n\x16\x17\x18\x19\x1A%&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyzƒ„…†‡ˆ‰Š’“”•–—˜™š¢£¤¥¦§¨©ª²³´µ¶·¸¹ºÂÃÄÅÆÇÈÉÊÒÓÔÕÖרÙÚáâãäåæçèéêñòóôõö÷øùúÿÄ \x1F\x01 \x03\x01\x01\x01\x01\x01\x01\x01\x01\x01 \x01\x02\x03\x04\x05\x06\a\b\t\r\n\vÿÄ µ\x11 \x02\x01\x02\x04\x04\x03\x04\a\x05\x04\x04 \x01\x02w \x01\x02\x03\x11\x04\x05!1\x06\x12AQ\aaq\x13\"2\x81\b\x14B‘¡±Á\t#3Rð\x15brÑ\r\n\x16$4á%ñ\x17\x18\x19\x1A&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz‚ƒ„…†‡ˆ‰Š’“”•–—˜™š¢£¤¥¦§¨©ª²³´µ¶·¸¹ºÂÃÄÅÆÇÈÉÊÒÓÔÕÖרÙÚâãäåæçèéêòóôõö÷øùúÿÚ \f\x03\x01 \x02\x11\x03\x11 ? ýü¢Š(\x03ÿÙ" headers: {} '400': description: '' content: application/json: schema: *ref_0 example: code: -2113 message: The parameter is not valid. statusCode: 400 headers: {} '403': description: '' content: application/json: schema: *ref_0 example: code: -1043 message: Password invalid. statusCode: 403 headers: {} '404': description: '' content: application/json: schema: *ref_0 example: code: -1040 message: The uid does not exist. statusCode: 404 headers: {} '405': description: Method not allowed content: application/json: schema: *ref_0 example: code: -2112 message: This endpoint only supports GET. statusCode: 405 headers: {} x-200-2: description: Error resonpse content: application/pdf: schema: *ref_0 example: "%PDF-1.5\r\n%¡³Å×\r\n1 0 obj\r\n<</Pages 2 0 R /Type/Catalog>>\r\nendobj\r\n2 0 obj\r\n<</Count 1/Kids[ 4 0 R ]/Type/Pages>>\r\nendobj\r\n3 0 obj\r\n<<>>\r\nendobj\r\n4 0 obj\r\n<</Contents 7 0 R /CropBox[ 0 -0.25 1 0.75]/MediaBox[ 0 0 0.75 0.75]/Parent 2 0 R /Resources<</ExtGState<</FXE1 5 0 R >>/XObject<</FXX1 6 0 R >>>>/Rotate 0/Type/Page>>\r\nendobj\r\n5 0 obj\r\n<</BM/Normal/CA 1/ca 1>>\r\nendobj\r\n6 0 obj\r\n<</BitsPerComponent 8/ColorSpace/DeviceRGB/Filter/DCTDecode/Height 1/Length 631/Subtype/Image/Type/XObject/Width 1>>stream\r\nÿØÿà \x10JFIF \x01\x01\x01 ` ` ÿÛ C \x06\x04\x05\x06\x05\x04\x06\x06\x05\x06\a\a\x06\b\r\n\x10\r\n\r\n\t\t\r\n\x14\x0E\x0F\f\x10\x17\x14\x18\x18\x17\x14\x16\x16\x1A\x1D%\x1F\x1A\e#\x1C\x16\x16 , #&')*)\x19\x1F-0-(0%()(ÿÛ C\x01\a\a\a\r\n\b\r\n\x13\r\n\r\n\x13(\x1A\x16\x1A((((((((((((((((((((((((((((((((((((((((((((((((((ÿÀ \x11\b \x01 \x01\x03\x01\" \x02\x11\x01\x03\x11\x01ÿÄ \x1F \x01\x05\x01\x01\x01\x01\x01\x01 \x01\x02\x03\x04\x05\x06\a\b\t\r\n\vÿÄ µ\x10 \x02\x01\x03\x03\x02\x04\x03\x05\x05\x04\x04 \x01}\x01\x02\x03 \x04\x11\x05\x12!1A\x06\x13Qa\a\"q\x142\x81‘¡\b#B±Á\x15RÑð$3br‚\t\r\n\x16\x17\x18\x19\x1A%&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyzƒ„…†‡ˆ‰Š’“”•–—˜™š¢£¤¥¦§¨©ª²³´µ¶·¸¹ºÂÃÄÅÆÇÈÉÊÒÓÔÕÖרÙÚáâãäåæçèéêñòóôõö÷øùúÿÄ \x1F\x01 \x03\x01\x01\x01\x01\x01\x01\x01\x01\x01 \x01\x02\x03\x04\x05\x06\a\b\t\r\n\vÿÄ µ\x11 \x02\x01\x02\x04\x04\x03\x04\a\x05\x04\x04 \x01\x02w \x01\x02\x03\x11\x04\x05!1\x06\x12AQ\aaq\x13\"2\x81\b\x14B‘¡±Á\t#3Rð\x15brÑ\r\n\x16$4á%ñ\x17\x18\x19\x1A&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz‚ƒ„…†‡ˆ‰Š’“”•–—˜™š¢£¤¥¦§¨©ª²³´µ¶·¸¹ºÂÃÄÅÆÇÈÉÊÒÓÔÕÖרÙÚâãäåæçèéêòóôõö÷øùúÿÚ \f\x03\x01 \x02\x11\x03\x11 ? ú¦Š(\_\x0FÿÙ\r\nendstream\r\nendobj\r\n7 0 obj\r\n<</Filter/FlateDecode/Length 39>>stream\r\nxœ+ä2Ð37U0 A\x18#9—\vÌW(JçÒw‹ˆ0TpÉW\bä\x02 ¹þ\bá\r\nendstream\r\nendobj\r\nxref\r\n0 8\r\n0000000000 65535 f\r\n0000000017 00000 n\r\n0000000066 00000 n\r\n0000000122 00000 n\r\n0000000145 00000 n\r\n0000000331 00000 n\r\n0000000374 00000 n\r\n0000001159 00000 n\r\ntrailer\r\n<<\r\n/Root 1 0 R\r\n/Info 3 0 R\r\n/Size 8\r\n/Tag /Dynamsoft\r\n>>\r\nstartxref\r\n1269\r\n%%EOF\r\n" headers: {} x-200-3: description: '' content: image/png: schema: type: object properties: {} example: "‰PNG\r\n\x1A\r\n \r\nIHDR \x01 \x01\b\x02 \x90wSÞ \x01sRGB ®Î\x1Cé \x04gAMA ±\x8F\vüa\x05 \tpHYs \x0Eà \x0EÃ\x01Ço¨d \fIDAT\x18Wcøÿÿ? \x05þ\x02þ§5\x81„ IEND®B`‚" headers: {} x-200-4: description: '' content: image/tiff: schema: type: object properties: {} example: "II* \x0E €?àP\x10 \x0F þ \x04 \x01 \x01\x04 \x01 \x01 \x01\x01\x04 \x01 \x01 \x02\x01\x03 \x03 È \x03\x01\x03 \x01 \x05 \x06\x01\x03 \x01 \x02 \x11\x01\x04 \x01 \b \x15\x01\x03 \x01 \x03 \x16\x01\x04 \x01 \x01 \x17\x01\x04 \x01 \x05 \x1A\x01\x05 \x01 Î \e\x01\x05 \x01 Ö \x1C\x01\x03 \x01 \x01 (\x01\x03 \x01 \x02 =\x01\x03 \x01 \x02 \b \b \b w\x01 è\x03 w\x01 è\x03 " headers: {} security: [] /storage/documents/{documentuid}/pages: post: summary: Insert new page(s) into an existing document. deprecated: false description: > By default, it will append the pages to the end of document. for multiple tiff, we will split it into multiple images. And for multiple pdf, we will also split it into multiple pages and save raw content. operationId: insertDocPage tags: - Document Management parameters: - name: documentuid in: path description: UID of document required: true example: '' schema: type: string - name: DWT-DOC-PASSWORD in: header description: the password of document in storage required: false example: '' schema: type: string maxLength: 32 description: cannot exceed 32 chars. requestBody: content: application/json: schema: type: object required: - source properties: insertPos: type: number description: > Positive integer. The new page will be inserted before this index. If not set or out of the maximum range, the blank page will be added after the last page. source: oneOf: - type: string example: - >- https://127.0.0.1:18623/api/device/scanners/jobs/dd40716d-48d1-4d32-89f7-1d53f9665d91/next-page?page=19522d0c5282 descriptio