UNPKG

drptranslator

Version:
85 lines (64 loc) 3.15 kB
[![Build Status](https://travis-ci.org/AngelMunoz/DRPTranslator.svg?branch=master)](https://travis-ci.org/AngelMunoz/DRPTranslator) # **NOTICE** - Since version 1.2.0 This library requires you to use **node 6+** # Hello everyone! Welcome to DNA-RNA-Protein Translator or if you may drptranslator I have a very bad problem of naming but don't let that stop you! **DRPTranslator** is a small library written in typescript, this is intended for a really low entry level of genetics, nothing really advanced since I'm not a genetist after all. However if you want this to help someone at school this can suit you well :) At the moment these are some of the usages of the principal uses: - Translate a DNA sequence into a RNA sequence - Obtain the complementary DNA sequence from another DNA sequence - Translate directly from DNA to an Aminoacid sequence - Translate RNA to an Aminoacid sequence - Find starts and stops codons in a sequence and some other cool stuff like a obtaining a *codon array* or find the *first and last start and stop sequence*. ## Install how can you consume this library? this is intended to be used in a nodejs environment so you can install it as a dependency `npm install --save drptranslator` ## Usage Tou can [Test it Here](https://npm.runkit.com/drptranslator) **Javascript** ```javascript const { RNATranslator, DNATranslator } = require("drptranslator"); const rTranslator = new RNATranslator(); const dTranslator = new DNATranslator(); const rnaAaSeq = rTranslator.transRNAtoAA("AUGGUCUGC"); const dnaAaSeq = dTranslator.transDNAtoAA("ATGGTCTGC"); const rnatodna = rTranslator.transRNAtoDNA("CCGAUCGAUCGCGAUCGAUCUUGCUCA"); const arnAASeq = rTranslator.transRNAtoAA("CCGAUCGAUCGCGAUCGAUCUUGCUCA"); const dnaAASeq = dTranslator.transDNAtoAA("GGCTAGCTAGCGCTAGCTAGAACGAGT"); console.log(rnaAaSeq, dnaAaSeq, arnAASeq, rnatodna, dnaAASeq); // "Met-Val-Cys" // "Tyr-Gln-Thr" // "Pro-Ile-Asp-Arg-Asp-Arg-Ser-Cys-Ser" // "GGCTAGCTAGCGCTAGCTAGAACGAGT" // "Pro-Ile-Asp-Arg-Asp-Arg-Ser-Cys-Ser" ``` **Typescript** ```javascript import { RNATranslator, DNATranslator } from "drptranslator"; const rTranslator = new RNATranslator(); const dTranslator = new DNATranslator(); const rnaAaSeq = rTranslator.transRNAtoAA("AUGGUCUGC"); const dnaAaSeq = dTranslator.transDNAtoAA("ATGGTCTGC"); const rnatodna = rTranslator.transRNAtoDNA("CCGAUCGAUCGCGAUCGAUCUUGCUCA"); const arnAASeq = rTranslator.transRNAtoAA("CCGAUCGAUCGCGAUCGAUCUUGCUCA"); const dnaAASeq = dTranslator.transDNAtoAA("GGCTAGCTAGCGCTAGCTAGAACGAGT"); console.log(rnaAaSeq, dnaAaSeq, arnAASeq, rnatodna, dnaAASeq); // "Met-Val-Cys" // "Tyr-Gln-Thr" // "Pro-Ile-Asp-Arg-Asp-Arg-Ser-Cys-Ser" // "GGCTAGCTAGCGCTAGCTAGAACGAGT" // "Pro-Ile-Asp-Arg-Asp-Arg-Ser-Cys-Ser" ``` ## What's next? * [x] Document source files * [x] Creating a website for its API docs * [ ] Publish a demo of an app using the library * [ ] Adding more cappabilities ### Suggestions If you have an idea or you want to help to make this something bigger, raise an issue :) I'm glad to check out your ideas!