UNPKG

bedjs

Version:

Manage BED (Browser Extensible Data) files with Node.JS (Bioinformatics)

200 lines (138 loc) 5.89 kB
# bedJS [![npm](https://img.shields.io/npm/v/bedjs.svg?style=flat-square)](https://www.npmjs.com/package/bedjs) [![npm](https://img.shields.io/npm/dt/bedjs.svg?style=flat-square)](https://www.npmjs.com/package/bedjs) Manage BED (Browser Extensible Data) files with Node.JS (Bioinformatics). ## Install Use NPM to install the package: ``` npm install bedjs ``` ## Overview ### About the BED file format A BED file is a tab delimited containing one feature of interest per line. Each line must contain at least the three first fields listed below: | KEY | Description | Type | |-----|-------------|------| | chromosome | Chromosome name | String | | start | Start position of the feature | Integer | | end | End position of the feature | Integer | | name | Name of the line | String | | score | Score between 0 and 1000 | Integer | | strand | Strand of the feature ('+' or '-') | String | | thickStart | Start position at which the feature is drawn thickly | Integer | | thickEnd | End position at which the feature is drawn thickly | Integer | | itemRgb | RGB value in format R,G,B | String | | blockCount | The number of blocks (exons) in the BED line | Integer | | blockSizes | A comma-separated list of the block sizes | String | | blockStarts | A comma-separated list of block starts | String | You can read more about the BED format [here](http://Mar2016.archive.ensembl.org/info/website/upload/bed.html). ### The BED object This tool will convert each line of a BED file in one JavaScript object, where each column of the BED file will be saved with the format `key=value`. The `key` attribute will be one of the previous table. Example of a BED file: ``` 1 6579260 6579725 PLEKHG5 1 10292069 10292214 KIF1B 1 33282660 33282997 YARS 1 156084621 156085204 LMNA ``` The previous BED file converted to a BED object will be: ```javascript [ { chromosome: '1', start: 6579260, end: 6579725, name: 'PLEKHG5' }, { chromosome: '1', start: 10292069, end: 10292214, name: 'KIF1B' }, { chromosome: '1', start: 33282660, end: 33282997, name: 'YARS' }, { chromosome: '1', start: 156084621, end: 156085204, name: 'LMNA' } ] ``` ## API Include the package in your JavaScript code using: ```javascript var bedJS = require('bedjs'); ``` ### bedJS.Read(file) Read a BED file. Returns an array with one BED object for each line of the BED file. ```javascript var bed = bedJS.Read('example.bed'); ``` ### bedJS.Write(file, bed) Save an array with BED objects to a BED file. ```javascript bedJS.Write('newfile.bed', bed); ``` ### bedJS.Collapse A class to combine all BED objects into a new object. The following combining methods are available: #### bedJS.Collapse.ByRegion(bed) Combines all BED objects with overlapping features into a new BED object. This method only combines all features that have the same chromosome and the same strand. Example of a BED object: ```javascript [ { "chromosome": "2", "start": 500, "end": 600, "name": "REGION1", "score": 0, "strand": "+" }, { "chromosome": "2", "start": 550, "end": 700, "name": "REGION2", "score": 0, "strand": "+" }, { "chromosome": "2", "start": 500, "end": 700, "name": "REGION3", "score": 0, "strand": "-" } ] ``` If now we run: ```javascript var bed2 = bedJS.Collapse.ByRegion(bed); ``` This will return the following array: ```javascript [ { "chromosome": "2", "start": 500, "end": 700, "name": "REGION1,REGION2", "score": 0, "strand": "+" }, { "chromosome": "2", "start": 500, "end": 700, "name": "REGION3", "score": 0, "strand": "-" } ] ``` #### bedJS.Collapse.ByName(bed) Combines all BED objects that have the same feature `name`. The output object will have the minimum start position and the maximum end position of all objects combined. Example of a BED object: ```javascript [ { "chromosome": "2", "start": 500, "end": 600, "name": "REGION1", "score": 0, "strand": "+" }, { "chromosome": "2", "start": 700, "end": 800, "name": "REGION1", "score": 0, "strand": "+" }, { "chromosome": "2", "start": 500, "end": 700, "name": "REGION2", "score": 0, "strand": "-" } ] ``` If now we run: ```javascript var bed2 = bedJS.Collapse.ByName(bed); ``` This will return the following array: ```javascript [ { "chromosome": "2", "start": 500, "end": 800, "name": "REGION1", "score": 0, "strand": "+" }, { "chromosome": "2", "start": 500, "end": 700, "name": "REGION3", "score": 0, "strand": "-" } ] ``` ### bedJS.Fasta A set of tools to work with Fasta files. #### bedJS.Fasta.Index(file) Create an index of your Fasta file in JSON format. This index is required if you want to use the `bedJS.Fasta.Get` function. ```javascript bedJS.Fasta.Index('fasta_file.fa'); ``` The previous command will generate a file called `fasta_file.fa.json`. Once you have created the index file, you don't need to run it again. #### bedJS.Fasta.Get(fasta, bed, opt) A method to extract sequences from a Fasta file using the regions delimited in your BED file or in your BED object. The inputs of this method are: - `fasta`: the path of your fasta file where you will extract the sequence. - `bed`: a BED object or the path to a BED file with the regions where you want to extract the sequence. - `opt`: an object with the following keys: - `strand`: set it to `true` if you want to extract the sequence with the same orientation defined in the BED file. Default is `false`. This will return an array with the sequence for each BED object. Note that you must run `bedJS.Fasta.Index` to index the Fasta file before run this function. Example of a Fasta file: ``` test.fa: >1 ACTGAAAAACCCGGTTTAACGTACCGG ``` Example of a bed file ``` test.bed: 1 5 10 ``` If you run: ```javascript var sequence = bedJS.Fasta.Get('test.fa', 'test.bed', { strand: false }); // -> sequence = [ { "head": "1:5-10", "sequence": "AAAAC"}] ``` ## License © [MIT LICENSE](./LICENSE) Jose M. Juanes.